sfn 2019

Human Stratifin (SFN) ELISA Kit
DL-SFN-Hu-48 1 kit of 48 tests
EUR 482.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Stratifin (SFN)
Human Stratifin (SFN) ELISA Kit
DL-SFN-Hu-96 1 kit of 96 tests
EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Stratifin (SFN)
Human Stratifin (SFN) ELISA Kit
DLR-SFN-Hu-48T 48T
EUR 517.00
  • Should the Human Stratifin (SFN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stratifin (SFN) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.
Human Stratifin (SFN) ELISA Kit
DLR-SFN-Hu-96T 96T
EUR 673.00
  • Should the Human Stratifin (SFN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stratifin (SFN) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.
Human Stratifin (SFN) ELISA Kit
RD-SFN-Hu-48Tests 48 Tests
EUR 521.00
Human Stratifin (SFN) ELISA Kit
RD-SFN-Hu-96Tests 96 Tests
EUR 723.00
Human Stratifin (SFN) ELISA Kit
RDR-SFN-Hu-48Tests 48 Tests
EUR 544.00
Human Stratifin (SFN) ELISA Kit
RDR-SFN-Hu-96Tests 96 Tests
EUR 756.00
SFN
E541-319 100ug
EUR 343.00
VIAL CAP INSERT,YEL,NS,BK,50/500
2019 50/pk
EUR 57.00
Description: Cryogenic Vials; Costar Cryogenic Inserts
SFN Antibody
1-CSB-PA008892
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SFN. Recognizes SFN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
SFN Antibody
43001-100ul 100ul
EUR 252.00
SFN antibody
70R-9288 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal SFN antibody
SFN antibody
70R-5570 50 ug
EUR 467.00
Description: Rabbit polyclonal SFN antibody raised against the middle region of SFN
SFN antibody
70R-20201 50 ul
EUR 435.00
Description: Rabbit polyclonal SFN antibody
SFN Antibody
ABD6189 100 ug
EUR 438.00
SFN Antibody
32126-100ul 100ul
EUR 252.00
SFN antibody
70R-14334 100 ug
EUR 322.00
Description: Affinity purified Rabbit polyclonal SFN antibody
SFN siRNA
20-abx933104
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SFN siRNA
20-abx933105
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SFN Antibody
1-CSB-PA021135GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SFN. Recognizes SFN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA
SFN Antibody
1-CSB-PA021135LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SFN. Recognizes SFN from Human, Rat, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:200-1:500
SFN antibody
PAab09897 100 ug
EUR 386.00
pOTB7-SFN
PVT18303 2 ug
EUR 231.00
SFN Antibody
DF6189 200ul
EUR 304.00
Description: SFN Antibody detects endogenous levels of total SFN.
Recombinant 2019-nCoV N protein
N-127V 100ug
EUR 1610.00
  • Concentration 1.0 mg/ml
Description: Recombinant 2019-nCoV N protein was expressed in E. coli and purified by Ni column.; Coronaviruses have positive-sense RNA genome and a nucleocapsid of helical symmetry.Coronavirus N protein is required for coronavirus RNA synthesis, and has RNA chaperone activity that may be involved in template switch.N protein of coronavirus is chosen as a diagnostic tool.
SFN Polyclonal Antibody
A-2745 100 µl
EUR 483.55
Description: kits suitable for this type of research
Stratifin (SFN) Antibody
20-abx115864
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
SFN cloning plasmid
CSB-CL021135HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 747
  • Sequence: atggagagagccagtctgatccagaaggccaagctggcagagcaggccgaacgctatgaggacatggcagccttcatgaaaggcgccgtggagaagggcgaggagctctcctgcgaagagcgaaacctgctctcagtagcctataagaacgtggtgggcggccagagggctgcctg
  • Show more
Description: A cloning plasmid for the SFN gene.
SFN cloning plasmid
CSB-CL021135HU2-10ug 10ug
EUR 292.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 651
  • Sequence: atggagagagccagtctgatccagaaggccaagctggcagagcaggccgaacgctatgaggacatggcagccttcatgaaaggcgccgtggagaagggcgaggagctctcctgcgaagagcgaaacctgctctcagtagcctataagaacgtggtgggcggccagagggctgcctg
  • Show more
Description: A cloning plasmid for the SFN gene.
SFN Blocking Peptide
33R-2923 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SFN antibody, catalog no. 70R-5570
SFN Blocking Peptide
33R-9879 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SFN antibody, catalog no. 70R-9288
Stratifin (SFN) Antibody
20-abx338920
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Stratifin (SFN) Antibody
20-abx325481
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Stratifin (SFN) Antibody
20-abx174650
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
SFN Conjugated Antibody
C32126 100ul
EUR 397.00
Stratifin (SFN) Antibody
20-abx100293
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Stratifin (SFN) Antibody
20-abx100294
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Recombinant Stratifin (SFN)
4-RPH179Hu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P31947
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.3kDa
  • Isoelectric Point: 4.9
Description: Recombinant Human Stratifin expressed in: E.coli
Recombinant Stratifin (SFN)
4-RPH179Mu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O70456
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.5kDa
  • Isoelectric Point: 5.1
Description: Recombinant Mouse Stratifin expressed in: E.coli
anti- SFN antibody
LSMab09897 100 ug
EUR 386.00
pCMV-SPORT6-SFN
PVT13720 2 ug
EUR 391.00
anti- SFN antibody
FNab09897 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: 14-3-3 protein sigma
  • Uniprot ID: P31947
  • Gene ID: 2810
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against SFN
SFN Rabbit pAb
A1026-100ul 100 ul
EUR 308.00
SFN Rabbit pAb
A1026-200ul 200 ul
EUR 459.00
SFN Rabbit pAb
A1026-20ul 20 ul
EUR 183.00
SFN Rabbit pAb
A1026-50ul 50 ul
EUR 223.00
SFN Blocking Peptide
DF6189-BP 1mg
EUR 195.00
Anti-SFN antibody
STJ119984 100 µl
EUR 413.00
Anti-SFN antibody
STJ25500 100 µl
EUR 277.00
Anti-SFN Antibody
STJ502960 100 µg
EUR 476.00
Mouse SFN shRNA Plasmid
20-abx974565
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human Stratifin (SFN) Protein
abx060030-100ug 100 ug
EUR 328.00
  • Shipped within 5-10 working days.
Human SFN shRNA Plasmid
20-abx951877
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Stratifin (SFN) Antibody (FITC)
20-abx273571
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Stratifin (SFN) Antibody (Biotin)
20-abx272403
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Stratifin (SFN) Antibody (HRP)
20-abx334440
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Stratifin (SFN) Antibody (FITC)
20-abx334441
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Stratifin (SFN) Antibody (Biotin)
20-abx334442
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human Stratifin (SFN) Protein
20-abx069174
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Mouse Stratifin (SFN) Protein
20-abx069176
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
SFN Antibody, HRP conjugated
1-CSB-PA021135LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SFN. Recognizes SFN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SFN Antibody, FITC conjugated
1-CSB-PA021135LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SFN. Recognizes SFN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SFN Antibody, Biotin conjugated
1-CSB-PA021135LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SFN. Recognizes SFN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SFN ELISA KIT|Human
EF005907 96 Tests
EUR 689.00
Human SFN ELISA Kit
ELA-E15106h 96 Tests
EUR 824.00
SFN Recombinant Protein (Human)
RP028300 100 ug Ask for price
SFN Recombinant Protein (Human)
RP028303 100 ug Ask for price
SFN Recombinant Protein (Mouse)
RP171359 100 ug Ask for price
Polyclonal SFN Antibody (Center)
APR17857G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN (Center). This antibody is tested and proven to work in the following applications:
Polyclonal SFN Antibody (Center)
APR13281G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN (Center). This antibody is tested and proven to work in the following applications:
Anti-SFN Antibody (Biotin)
STJ502961 100 µg
EUR 586.00
Anti-SFN Antibody (FITC)
STJ502962 100 µg
EUR 586.00
LCK antibody
10R-2019 100 ul
EUR 435.00
Description: Mouse monoclonal LCK antibody
alpha Synuclein antibody
20R-2019 50 ug
EUR 281.00
Description: Rabbit polyclonal alpha Synuclein antibody
EZH2 Polyclonal Antibody
A-2019 100 µl
EUR 628.55
Description: The best epigenetics products
TRIM54 antibody
70R-2019 50 ug
EUR 467.00
Description: Rabbit polyclonal TRIM54 antibody raised against the N terminal of TRIM54
FKBP1B protein (His tag)
80R-2019 100 ug
EUR 322.00
Description: Recombinant human FKBP1B protein (His tag)
FAM71A Blocking Peptide
33R-2019 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FAM71A antibody, catalog no. 70R-4190
SQ 22536
2019-25
EUR 648.00
SQ 22536
2019-5
EUR 207.00
IFN beta antibody (HRP)
60R-2019 100 ug
EUR 349.00
Description: Rabbit polyclonal IFN beta antibody (HRP)
EpiQuik Methylated DNA Immunoprecipitation Kit
P-2019 48 Reactions
EUR 889.55
Description: Ask the seller for details
Human Stratifin (SFN) ELISA Kit
20-abx153184
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Stratifin (SFN)ELISA Kit
201-12-2409 96 tests
EUR 440.00
  • This Stratifin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.