SNCA

Human Synuclein Alpha (SNCa) ELISA Kit
DLR-SNCa-Hu-96T 96T
EUR 647
  • Should the Human Synuclein Alpha (SNCa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Synuclein Alpha (SNCa) in samples from serum, plasma or other biological fluids.
Mouse Synuclein Alpha (SNCa) ELISA Kit
DLR-SNCa-Mu-48T 48T
EUR 508
  • Should the Mouse Synuclein Alpha (SNCa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Synuclein Alpha (SNCa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Synuclein Alpha (SNCa) ELISA Kit
DLR-SNCa-Mu-96T 96T
EUR 661
  • Should the Mouse Synuclein Alpha (SNCa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Synuclein Alpha (SNCa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat Synuclein Alpha (SNCa) ELISA Kit
DLR-SNCa-Ra-48T 48T
EUR 528
  • Should the Rat Synuclein Alpha (SNCa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Synuclein Alpha (SNCa) in samples from serum, plasma, tissue homogenates or other biological fluids.
Rat Synuclein Alpha (SNCa) ELISA Kit
DLR-SNCa-Ra-96T 96T
EUR 690
  • Should the Rat Synuclein Alpha (SNCa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Synuclein Alpha (SNCa) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Synuclein Alpha (SNCa) ELISA Kit
RD-SNCa-Hu-48Tests 48 Tests
EUR 500
Human Synuclein Alpha (SNCa) ELISA Kit
RD-SNCa-Hu-96Tests 96 Tests
EUR 692
Mouse Synuclein Alpha (SNCa) ELISA Kit
RD-SNCa-Mu-48Tests 48 Tests
EUR 511
Mouse Synuclein Alpha (SNCa) ELISA Kit
RD-SNCa-Mu-96Tests 96 Tests
EUR 709
Rat Synuclein Alpha (SNCa) ELISA Kit
RD-SNCa-Ra-48Tests 48 Tests
EUR 534
Rat Synuclein Alpha (SNCa) ELISA Kit
RD-SNCa-Ra-96Tests 96 Tests
EUR 742
Human Synuclein Alpha (SNCa) ELISA Kit
RDR-SNCa-Hu-48Tests 48 Tests
EUR 522
Human Synuclein Alpha (SNCa) ELISA Kit
RDR-SNCa-Hu-96Tests 96 Tests
EUR 724
Mouse Synuclein Alpha (SNCa) ELISA Kit
RDR-SNCa-Mu-48Tests 48 Tests
EUR 534
Mouse Synuclein Alpha (SNCa) ELISA Kit
RDR-SNCa-Mu-96Tests 96 Tests
EUR 742
Rat Synuclein Alpha (SNCa) ELISA Kit
RDR-SNCa-Ra-48Tests 48 Tests
EUR 558
Rat Synuclein Alpha (SNCa) ELISA Kit
RDR-SNCa-Ra-96Tests 96 Tests
EUR 776
SNCA siRNA
20-abx905175
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SNCA Antibody
BF0582 200ul
EUR 376
Description: SNCA antibody detects endogenous levels of total SNCA.
SNCA Antibody
37420-100ul 100ul
EUR 252
SNCA antibody
10R-8354 100 ul
EUR 349
Description: Mouse monoclonal SNCA antibody
SNCA protein
30R-1619 100 ug
EUR 305
Description: Purified recombinant mouse SNCA protein
SNCA antibody
70R-20421 50 ul
EUR 435
Description: Rabbit polyclonal SNCA antibody
SNCA siRNA
20-abx934511
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SNCA siRNA
20-abx934512
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SNCA Antibody
1-CSB-PA004209
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SNCA. Recognizes SNCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
SNCA Antibody
1-CSB-PA004210
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SNCA. Recognizes SNCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000
SNCA Antibody
1-CSB-PA004212
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SNCA. Recognizes SNCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000
SNCA Antibody
1-CSB-PA592134
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SNCA. Recognizes SNCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100
SNCA Antibody
1-CSB-PA169656
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SNCA. Recognizes SNCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
SNCA Antibody
CSB-PA036896-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SNCA. Recognizes SNCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
SNCA Antibody
CSB-PA036896-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SNCA. Recognizes SNCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
SNCA Antibody
1-CSB-PA050116
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SNCA. Recognizes SNCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000
SNCA Antibody
1-CSB-PA06994A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SNCA. Recognizes SNCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
SNCA Antibody
1-CSB-PA06997A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SNCA. Recognizes SNCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
Snca Antibody
1-CSB-PA021912DA01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Snca. Recognizes Snca from Rat. This antibody is Unconjugated. Tested in the following application: ELISA
SNCA Antibody
1-CSB-PA021912DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SNCA. Recognizes SNCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
SNCA Antibody
1-CSB-PA021912GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SNCA. Recognizes SNCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
SNCA Antibody
1-CSB-PA021912OA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against SNCA. Recognizes SNCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
pET28a-SNCA
PVT18122 2 ug
EUR 258
pOTB7-SNCA
PVT17427 2 ug
EUR 231
SNCA Conjugated Antibody
C37420 100ul
EUR 397
SNCA Blocking Peptide
BF0582-BP 1mg
EUR 195
Polyclonal SNCA Antibody
APR13427G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SNCA . This antibody is tested and proven to work in the following applications:
SNCA cloning plasmid
CSB-CL021912HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 423
  • Sequence: atggatgtattcatgaaaggactttcaaaggccaaggagggagttgtggctgctgctgagaaaaccaaacagggtgtggcagaagcagcaggaaagacaaaagagggtgttctctatgtaggctccaaaaccaaggagggagtggtgcatggtgtggcaacagtggctgagaagac
  • Show more
Description: A cloning plasmid for the SNCA gene.
SNCA (pY125) Antibody
20-abx000293
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
SNCA (pY136) Antibody
20-abx000305
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
SNCA (pS129) Antibody
20-abx000497
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
SNCA (pY133) Antibody
20-abx000498
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
SNCA Rabbit pAb
A7215-100ul 100 ul
EUR 308
SNCA Rabbit pAb
A7215-200ul 200 ul
EUR 459
SNCA Rabbit pAb
A7215-20ul 20 ul
EUR 183
SNCA Rabbit pAb
A7215-50ul 50 ul
EUR 223
SNCA Rabbit pAb
A0012-100ul 100 ul
EUR 308
SNCA Rabbit pAb
A0012-200ul 200 ul
EUR 459
SNCA Rabbit pAb
A0012-20ul 20 ul Ask for price
SNCA Rabbit pAb
A0012-50ul 50 ul Ask for price
SNCA Polyclonal Antibody
A56511 100 µg
EUR 570.55
Description: kits suitable for this type of research
SNCA Polyclonal Antibody
A54037 100 µg
EUR 570.55
Description: The best epigenetics products
Snca Polyclonal Antibody
A55267 100 µg
EUR 570.55
Description: fast delivery possible
SNCA Rabbit pAb
A13354-100ul 100 ul
EUR 308
SNCA Rabbit pAb
A13354-200ul 200 ul
EUR 459
SNCA Rabbit pAb
A13354-20ul 20 ul
EUR 183
SNCA Rabbit pAb
A13354-50ul 50 ul
EUR 223
SNCA antibody (ser129)
70R-14938 100 ul
EUR 392
Description: Rabbit polyclonal SNCA antibody (ser129)
anti-SNCA (2B2D1)
LF-MA30063 100 ul
EUR 486
Description: Mouse Monoclonal to SNCA
Anti-SNCA Antibody
STJ501861 100 µg
EUR 476
Anti-SNCA antibody
STJ29295 100 µl
EUR 277
Description: Alpha-synuclein is a member of the synuclein family, which also includes beta- and gamma-synuclein. Synucleins are abundantly expressed in the brain and alpha- and beta-synuclein inhibit phospholipase D2 selectively. SNCA may serve to integrate presynaptic signaling and membrane trafficking. Defects in SNCA have been implicated in the pathogenesis of Parkinson disease. SNCA peptides are a major component of amyloid plaques in the brains of patients with Alzheimer's disease. Alternatively spliced transcripts encoding different isoforms have been identified for this gene.
Anti-SNCA antibody
STJ25639 100 µl
EUR 277
Description: Alpha-synuclein is a member of the synuclein family, which also includes beta- and gamma-synuclein. Synucleins are abundantly expressed in the brain and alpha- and beta-synuclein inhibit phospholipase D2 selectively. SNCA may serve to integrate presynaptic signaling and membrane trafficking. Defects in SNCA have been implicated in the pathogenesis of Parkinson disease. SNCA peptides are a major component of amyloid plaques in the brains of patients with Alzheimer's disease. Alternatively spliced transcripts encoding different isoforms have been identified for this gene.
Anti-SNCA antibody
STJ115317 100 µl
EUR 277
Description: Alpha-synuclein is a member of the synuclein family, which also includes beta- and gamma-synuclein. Synucleins are abundantly expressed in the brain and alpha- and beta-synuclein inhibit phospholipase D2 selectively. SNCA may serve to integrate presynaptic signaling and membrane trafficking. Defects in SNCA have been implicated in the pathogenesis of Parkinson disease. SNCA peptides are a major component of amyloid plaques in the brains of patients with Alzheimer's disease. Alternatively spliced transcripts encoding different isoforms have been identified for this gene.
Rat SNCA shRNA Plasmid
20-abx985359
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SNCa ELISA Kit
EHS0138 96Tests
EUR 521
Human SNCA ELISA Kit
ELA-E1222h 96 Tests
EUR 824
Goat SNCa ELISA Kit
EGTS0138 96Tests
EUR 521
Bovine SNCa ELISA Kit
EBS0138 96Tests
EUR 521
Chicken SNCa ELISA Kit
ECKS0138 96Tests
EUR 521
SNCA (α-synuclein) protein
E62B012 20ug
EUR 343
Anserini SNCa ELISA Kit
EAS0138 96Tests
EUR 521
Canine SNCa ELISA Kit
ECS0138 96Tests
EUR 521
SNCA ELISA KIT|Human
EF006874 96 Tests
EUR 689
Porcine SNCa ELISA Kit
EPS0138 96Tests
EUR 521
Rat SNCa ELISA Kit
ERS0138 96Tests
EUR 521
Sheep SNCa ELISA Kit
ESS0138 96Tests
EUR 521
Rabbit SNCa ELISA Kit
ERTS0138 96Tests
EUR 521
Monkey SNCa ELISA Kit
EMKS0138 96Tests
EUR 521