Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
DLR-STAT4-Hu-96T 96T
EUR 647
  • Should the Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Signal Transducer And Activator Of Transcription 4 (STAT4) in samples from tissue homogenates, cell lysates or other biological fluids.
Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
DLR-STAT4-Ra-48T 48T
EUR 498
  • Should the Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Signal Transducer And Activator Of Transcription 4 (STAT4) in samples from tissue homogenates, cell lysates or other biological fluids.
Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
DLR-STAT4-Ra-96T 96T
EUR 647
  • Should the Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Signal Transducer And Activator Of Transcription 4 (STAT4) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RD-STAT4-Hu-48Tests 48 Tests
EUR 500
Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RD-STAT4-Hu-96Tests 96 Tests
EUR 692
Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RD-STAT4-Ra-48Tests 48 Tests
EUR 500
Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RD-STAT4-Ra-96Tests 96 Tests
EUR 692
Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RDR-STAT4-Hu-48Tests 48 Tests
EUR 522
Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RDR-STAT4-Hu-96Tests 96 Tests
EUR 724
Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RDR-STAT4-Ra-48Tests 48 Tests
EUR 522
Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RDR-STAT4-Ra-96Tests 96 Tests
EUR 724
Stat4 antibody
20R-1594 100 ug
EUR 673
Description: Rabbit polyclonal Stat4 antibody
STAT4 antibody
20R-1913 50 ug
EUR 281
Description: Rabbit polyclonal STAT4 antibody
STAT4 antibody
20R-2229 50 ug
EUR 281
Description: Rabbit polyclonal STAT4 antibody
STAT4 antibody
70R-11849 100 ug
EUR 403
Description: Rabbit polyclonal STAT4 antibody
STAT4 antibody
70R-20574 50 ul
EUR 435
Description: Rabbit polyclonal STAT4 antibody
STAT4 antibody
70R-30641 100 ug
EUR 327
Description: Rabbit polyclonal STAT4 antibody
Stat4 antibody
70R-14229 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal Stat4 antibody
Stat4 Antibody
EUR 316
Stat4 Antibody
EUR 146
STAT4 antibody
10R-5957 100 ul
EUR 726
Description: Mouse monoclonal STAT4 antibody
STAT4 antibody
10R-5958 100 ul
EUR 691
Description: Mouse monoclonal STAT4 antibody
STAT4 antibody
10R-5959 100 ul
EUR 691
Description: Mouse monoclonal STAT4 antibody
STAT4 antibody
10R-5961 100 ul
EUR 691
Description: Mouse monoclonal STAT4 antibody
STAT4 antibody
10R-5962 100 ul
EUR 691
Description: Mouse monoclonal STAT4 antibody
STAT4 antibody
10R-5963 100 ul
EUR 691
Description: Mouse monoclonal STAT4 antibody
STAT4 antibody
10R-5964 100 ul
EUR 691
Description: Mouse monoclonal STAT4 antibody
STAT4 antibody
10R-5967 100 ul
EUR 691
Description: Mouse monoclonal STAT4 antibody
STAT4 Antibody
49252-100ul 100ul
EUR 333
STAT4 Antibody
49252-50ul 50ul
EUR 239
STAT4 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IP, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IP:2-5ug/mglysate.ELISA:1/5000
STAT4 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000
STAT4 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:50-200
STAT4 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:3000, IHC:1:50-1:200
STAT4 antibody
70R-37487 100 ug
EUR 273
Description: Rabbit Polyclonal STAT4 antibody
STAT4 antibody
70R-51643 100 ul
EUR 287
Description: Purified Polyclonal STAT4 antibody
STAT4 antibody
70R-32517 100 ug
EUR 327
Description: Rabbit polyclonal STAT4 antibody
STAT4 protein
E20-80104 20ug
EUR 408
STAT4 protein
E20-80105 20ug
EUR 408
STAT4 Antibody
AF6441 200ul
EUR 304
Description: STAT4 Antibody detects endogenous levels of total STAT4.
STAT4 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200
STAT4 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
STAT4 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200
STAT4 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
STAT4 Antibody
ABF6441 100 ug
EUR 438
YF-PA14815 50 ul
EUR 363
Description: Mouse polyclonal to STAT4
YF-PA14816 100 ug
EUR 403
Description: Rabbit polyclonal to STAT4
YF-PA24780 50 ul
EUR 334
Description: Mouse polyclonal to STAT4
Stat4 Blocking Peptide
33R-10499 50 ug
EUR 349
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Stat4 antibody, catalog no. 20R-1594
STAT4 Blocking Peptide
33R-10775 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STAT4 antibody, catalog no. 70R-11849
Stat4 Blocking Peptide
EUR 153
STAT4 antibody (Tyr693)
70R-37128 100 ug
EUR 349
Description: Rabbit Polyclonal STAT4 antibody (Tyr693)
STAT4 antibody (Tyr693)
70R-32516 100 ug
EUR 327
Description: Rabbit polyclonal STAT4 antibody (Tyr693)
STAT4 (pS721) Antibody
abx218786-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
STAT4 (pY693) Antibody
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
STAT4 (pY693) Antibody
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
STAT4 (pY693) Antibody
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
STAT4 (pY693) Antibody
abx011816-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
STAT4 Blocking Peptide
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
STAT4 Polyclonal Antibody
EA238-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against STAT4 from Human. This antibody is tested and validated for WB, ELISA, IHC
STAT4 Polyclonal Antibody
EA238-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against STAT4 from Human. This antibody is tested and validated for WB, ELISA, IHC
STAT4 Conjugated Antibody
C49252 100ul
EUR 397
STAT4 Blocking Peptide
AF6441-BP 1mg
EUR 195
STAT4 cloning plasmid
CSB-CL022813HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2247
  • Sequence: atgtctcagtggaatcaagtccaacagttagaaatcaagtttttggagcaggtggatcaattctatgatgacaactttcccatggaaattcggcatctgttggcccaatggattgaaaatcaagactgggaggcagcttctaacaatgaaaccatggcaacgattcttcttcaaa
  • Show more
Description: A cloning plasmid for the STAT4 gene.
Stat4 Polyclonal Antibody
ABP52514-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
  • Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human, Mouse, Rat. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
Stat4 Polyclonal Antibody
ABP52514-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
  • Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human, Mouse, Rat. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
Stat4 Polyclonal Antibody
ABP52514-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
  • Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human, Mouse, Rat. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
STAT4 Rabbit pAb
A6991-100ul 100 ul
EUR 308
STAT4 Rabbit pAb
A6991-200ul 200 ul
EUR 459
STAT4 Rabbit pAb
A6991-20ul 20 ul
EUR 183
STAT4 Rabbit pAb
A6991-50ul 50 ul
EUR 223
STAT4 Rabbit pAb
A2638-100ul 100 ul
EUR 308
STAT4 Rabbit pAb
A2638-200ul 200 ul
EUR 459
STAT4 Rabbit pAb
A2638-20ul 20 ul
EUR 183
STAT4 Rabbit pAb
A2638-50ul 50 ul
EUR 223
STAT4 Rabbit mAb
A4523-100ul 100 ul
EUR 410
STAT4 Rabbit mAb
A4523-200ul 200 ul
EUR 571
STAT4 Rabbit mAb
A4523-20ul 20 ul
EUR 221
STAT4 Rabbit mAb
A4523-50ul 50 ul
EUR 287
Stat4 Polyclonal Antibody
ABP57268-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
  • Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
Stat4 Polyclonal Antibody
ABP57268-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
  • Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
Stat4 Polyclonal Antibody
ABP57268-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
  • Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
Stat4 Polyclonal Antibody
ABP57269-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
  • Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693