STAT4

Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
DL-STAT4-Hu-48	DLdevelop	1 kit of 48 tests	EUR 465.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Signal Transducer And Activator Of Transcription 4 (STAT4)

Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
DL-STAT4-Hu-96	DLdevelop	1 kit of 96 tests	EUR 621.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Signal Transducer And Activator Of Transcription 4 (STAT4)

Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
DL-STAT4-Ra-192	DLdevelop	1 kit of 192 tests	EUR 1103.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Signal Transducer And Activator Of Transcription 4 (STAT4)

Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
DL-STAT4-Ra-48	DLdevelop	1 kit of 48 tests	EUR 465.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Signal Transducer And Activator Of Transcription 4 (STAT4)

Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
DL-STAT4-Ra-96	DLdevelop	1 kit of 96 tests	EUR 621.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Signal Transducer And Activator Of Transcription 4 (STAT4)

Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
DLR-STAT4-Hu-48T	DL Develop	48T	EUR 498.00
Should the Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Signal Transducer And Activator Of Transcription 4 (STAT4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
DLR-STAT4-Hu-96T	DL Develop	96T	EUR 647.00
Should the Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Signal Transducer And Activator Of Transcription 4 (STAT4) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
DLR-STAT4-Ra-48T	DL Develop	48T	EUR 498.00
Should the Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Signal Transducer And Activator Of Transcription 4 (STAT4) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
DLR-STAT4-Ra-96T	DL Develop	96T	EUR 647.00
Should the Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Signal Transducer And Activator Of Transcription 4 (STAT4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RD-STAT4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500.00

Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RD-STAT4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692.00

Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RD-STAT4-Ra-48Tests	Reddot Biotech	48 Tests	EUR 500.00

Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RD-STAT4-Ra-96Tests	Reddot Biotech	96 Tests	EUR 692.00

Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RDR-STAT4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522.00

Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RDR-STAT4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724.00

Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RDR-STAT4-Ra-48Tests	Reddot Biotech	48 Tests	EUR 522.00

Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RDR-STAT4-Ra-96Tests	Reddot Biotech	96 Tests	EUR 724.00

STAT4 Antibody
1-CSB-PA004176	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IP, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IP:2-5ug/mglysate.ELISA:1/5000

STAT4 antibody
10R-5957	Fitzgerald	100 ul	EUR 726.00
Description: Mouse monoclonal STAT4 antibody

STAT4 antibody
10R-5958	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal STAT4 antibody

STAT4 antibody
10R-5959	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal STAT4 antibody

STAT4 antibody
10R-5961	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal STAT4 antibody

STAT4 antibody
10R-5962	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal STAT4 antibody

STAT4 antibody
10R-5963	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal STAT4 antibody

STAT4 antibody
10R-5964	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal STAT4 antibody

STAT4 antibody
10R-5967	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal STAT4 antibody

Stat4 antibody
20R-1594	Fitzgerald	100 ug	EUR 673.00
Description: Rabbit polyclonal Stat4 antibody

STAT4 antibody
20R-1913	Fitzgerald	50 ug	EUR 281.00
Description: Rabbit polyclonal STAT4 antibody

STAT4 antibody
20R-2229	Fitzgerald	50 ug	EUR 281.00
Description: Rabbit polyclonal STAT4 antibody

STAT4 Antibody
49252-100ul	SAB	100ul	EUR 333.00

STAT4 Antibody
49252-50ul	SAB	50ul	EUR 239.00

STAT4 antibody
70R-37487	Fitzgerald	100 ug	EUR 273.00
Description: Rabbit Polyclonal STAT4 antibody

STAT4 antibody
70R-51643	Fitzgerald	100 ul	EUR 287.00
Description: Purified Polyclonal STAT4 antibody

STAT4 antibody
70R-30641	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal STAT4 antibody

STAT4 antibody
70R-20574	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal STAT4 antibody

STAT4 antibody
70R-32517	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal STAT4 antibody

STAT4 Antibody
ABF6441	Lifescience Market	100 ug	EUR 438.00

Stat4 Antibody
3471R-100	Biovision		EUR 316.00

Stat4 Antibody
3471R-30T	Biovision		EUR 146.00

STAT4 antibody
70R-11849	Fitzgerald	100 ug	EUR 403.00
Description: Rabbit polyclonal STAT4 antibody

Stat4 antibody
70R-14229	Fitzgerald	100 ug	EUR 322.00
Description: Affinity purified Rabbit polyclonal Stat4 antibody

STAT4 siRNA
20-abx935410	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STAT4 siRNA
20-abx935411	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STAT4 Antibody
1-CSB-PA022813EA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

STAT4 Antibody
1-CSB-PA022813ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STAT4 Antibody
1-CSB-PA022813ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

STAT4 Antibody
1-CSB-PA022813GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

STAT4 Antibody
1-CSB-PA050166	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

STAT4 Antibody
1-CSB-PA080250	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:50-200

STAT4 Antibody
1-CSB-PA130463	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:3000, IHC:1:50-1:200

STAT4 protein
E20-80104	EnoGene	20ug	EUR 408.00

STAT4 protein
E20-80105	EnoGene	20ug	EUR 408.00

anti-STAT4
YF-PA14815	Abfrontier	50 ul	EUR 363.00
Description: Mouse polyclonal to STAT4

anti-STAT4
YF-PA14816	Abfrontier	100 ug	EUR 403.00
Description: Rabbit polyclonal to STAT4

anti-STAT4
YF-PA24780	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to STAT4

STAT4 Antibody
AF6441	Affbiotech	200ul	EUR 304.00
Description: STAT4 Antibody detects endogenous levels of total STAT4.

STAT4 antibody (Tyr693)
70R-37128	Fitzgerald	100 ug	EUR 349.00
Description: Rabbit Polyclonal STAT4 antibody (Tyr693)

STAT4 antibody (Tyr693)
70R-32516	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal STAT4 antibody (Tyr693)

Stat4 Polyclonal Antibody
ABP52514-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693 Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human, Mouse, Rat. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693

Stat4 Polyclonal Antibody
ABP52514-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693 Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human, Mouse, Rat. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693

Stat4 Polyclonal Antibody
ABP52514-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693 Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human, Mouse, Rat. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693

Stat4 Polyclonal Antibody
ABP57268-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693 Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693

Stat4 Polyclonal Antibody
ABP57268-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693 Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693

Stat4 Polyclonal Antibody
ABP57268-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693 Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693

Stat4 Polyclonal Antibody
ABP57269-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693 Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693

Stat4 Polyclonal Antibody
ABP57269-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693 Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693

Stat4 Polyclonal Antibody
ABP57269-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693 Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693

Stat4 Polyclonal Antibody
ABP56299-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693 Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human, Mouse, Rat. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693

Stat4 Polyclonal Antibody
ABP56299-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693 Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human, Mouse, Rat. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693

Stat4 Polyclonal Antibody
ABP56299-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693 Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human, Mouse, Rat. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693

STAT4 (pY693) Antibody
abx011816-100ug	Abbexa	100 ug	EUR 439.00
Shipped within 5-10 working days.

STAT4 (pY693) Antibody
20-abx000189	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

STAT4 Blocking Peptide
20-abx061715	Abbexa	EUR 258.00 EUR 384.00	1 mg 5 mg
Shipped within 5-10 working days.

STAT4 (pY693) Antibody
20-abx133340	Abbexa	EUR 314.00 EUR 467.00 EUR 203.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

STAT4 (pY693) Antibody
20-abx134579	Abbexa	EUR 314.00 EUR 467.00 EUR 203.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

STAT4 (pY693) Antibody
20-abx119324	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

STAT4 cloning plasmid
CSB-CL022813HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2247 Sequence: atgtctcagtggaatcaagtccaacagttagaaatcaagtttttggagcaggtggatcaattctatgatgacaactttcccatggaaattcggcatctgttggcccaatggattgaaaatcaagactgggaggcagcttctaacaatgaaaccatggcaacgattcttcttcaaa Show more
Description: A cloning plasmid for the STAT4 gene.

Stat4 Blocking Peptide
33R-10499	Fitzgerald	50 ug	EUR 349.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Stat4 antibody, catalog no. 20R-1594

STAT4 Blocking Peptide
33R-10775	Fitzgerald	50 ug	EUR 191.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STAT4 antibody, catalog no. 70R-11849

Stat4 Blocking Peptide
3471RBP-50	Biovision		EUR 153.00

STAT4 (pS721) Antibody
abx218786-100ug	Abbexa	100 ug	EUR 439.00
Shipped within 5-10 working days.

STAT4 Conjugated Antibody
C49252	SAB	100ul	EUR 397.00

STAT4 Polyclonal Antibody
E-AB-36003-120uL	Elabscience Biotechnology	120uL	EUR 257.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4. Purified by: Affinity purification Background: Carries out a dual function: signal transduction and activation of transcription. Involved i Show more
Description: Rabbit antibody against Human STAT4 for WB,IHC-p applications.

STAT4 Polyclonal Antibody
E-AB-36003-20uL	Elabscience Biotechnology	20uL	EUR 130.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4. Purified by: Affinity purification Background: Carries out a dual function: signal transduction and activation of transcription. Involved i Show more
Description: Rabbit antibody against Human STAT4 for WB,IHC-p applications.

STAT4 Polyclonal Antibody
E-AB-36003-60uL	Elabscience Biotechnology	60uL	EUR 175.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4. Purified by: Affinity purification Background: Carries out a dual function: signal transduction and activation of transcription. Involved i Show more
Description: Rabbit antibody against Human STAT4 for WB,IHC-p applications.