STAT4

Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
DLR-STAT4-Hu-96T 96T
EUR 647.00
  • Should the Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Signal Transducer And Activator Of Transcription 4 (STAT4) in samples from tissue homogenates, cell lysates or other biological fluids.
Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
DLR-STAT4-Ra-48T 48T
EUR 498.00
  • Should the Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Signal Transducer And Activator Of Transcription 4 (STAT4) in samples from tissue homogenates, cell lysates or other biological fluids.
Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
DLR-STAT4-Ra-96T 96T
EUR 647.00
  • Should the Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Signal Transducer And Activator Of Transcription 4 (STAT4) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RD-STAT4-Hu-48Tests 48 Tests
EUR 500.00
Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RD-STAT4-Hu-96Tests 96 Tests
EUR 692.00
Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RD-STAT4-Ra-48Tests 48 Tests
EUR 500.00
Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RD-STAT4-Ra-96Tests 96 Tests
EUR 692.00
Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RDR-STAT4-Hu-48Tests 48 Tests
EUR 522.00
Human Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RDR-STAT4-Hu-96Tests 96 Tests
EUR 724.00
Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RDR-STAT4-Ra-48Tests 48 Tests
EUR 522.00
Rat Signal Transducer And Activator Of Transcription 4 (STAT4) ELISA Kit
RDR-STAT4-Ra-96Tests 96 Tests
EUR 724.00
Stat4 antibody
20R-1594 100 ug
EUR 673.00
Description: Rabbit polyclonal Stat4 antibody
STAT4 antibody
20R-1913 50 ug
EUR 281.00
Description: Rabbit polyclonal STAT4 antibody
STAT4 antibody
20R-2229 50 ug
EUR 281.00
Description: Rabbit polyclonal STAT4 antibody
STAT4 antibody
70R-11849 100 ug
EUR 403.00
Description: Rabbit polyclonal STAT4 antibody
STAT4 antibody
70R-20574 50 ul
EUR 435.00
Description: Rabbit polyclonal STAT4 antibody
STAT4 antibody
70R-30641 100 ug
EUR 327.00
Description: Rabbit polyclonal STAT4 antibody
Stat4 antibody
70R-14229 100 ug
EUR 322.00
Description: Affinity purified Rabbit polyclonal Stat4 antibody
Stat4 Antibody
3471R-100
EUR 316.00
Stat4 Antibody
3471R-30T
EUR 146.00
STAT4 antibody
10R-5957 100 ul
EUR 726.00
Description: Mouse monoclonal STAT4 antibody
STAT4 antibody
10R-5958 100 ul
EUR 691.00
Description: Mouse monoclonal STAT4 antibody
STAT4 antibody
10R-5959 100 ul
EUR 691.00
Description: Mouse monoclonal STAT4 antibody
STAT4 antibody
10R-5961 100 ul
EUR 691.00
Description: Mouse monoclonal STAT4 antibody
STAT4 antibody
10R-5962 100 ul
EUR 691.00
Description: Mouse monoclonal STAT4 antibody
STAT4 antibody
10R-5963 100 ul
EUR 691.00
Description: Mouse monoclonal STAT4 antibody
STAT4 antibody
10R-5964 100 ul
EUR 691.00
Description: Mouse monoclonal STAT4 antibody
STAT4 antibody
10R-5967 100 ul
EUR 691.00
Description: Mouse monoclonal STAT4 antibody
STAT4 Antibody
49252-100ul 100ul
EUR 333.00
STAT4 Antibody
49252-50ul 50ul
EUR 239.00
STAT4 Antibody
1-CSB-PA004176
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IP, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IP:2-5ug/mglysate.ELISA:1/5000
STAT4 Antibody
1-CSB-PA050166
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000
STAT4 Antibody
1-CSB-PA080250
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:50-200
STAT4 Antibody
1-CSB-PA130463
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:3000, IHC:1:50-1:200
STAT4 antibody
70R-37487 100 ug
EUR 273.00
Description: Rabbit Polyclonal STAT4 antibody
STAT4 antibody
70R-51643 100 ul
EUR 287.00
Description: Purified Polyclonal STAT4 antibody
STAT4 antibody
70R-32517 100 ug
EUR 327.00
Description: Rabbit polyclonal STAT4 antibody
STAT4 protein
E20-80104 20ug
EUR 408.00
STAT4 protein
E20-80105 20ug
EUR 408.00
STAT4 Antibody
AF6441 200ul
EUR 304.00
Description: STAT4 Antibody detects endogenous levels of total STAT4.
STAT4 Antibody
1-CSB-PA022813EA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200
STAT4 Antibody
1-CSB-PA022813ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
STAT4 Antibody
1-CSB-PA022813ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200
STAT4 Antibody
1-CSB-PA022813GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STAT4. Recognizes STAT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
STAT4 siRNA
20-abx935410
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
STAT4 siRNA
20-abx935411
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
STAT4 Antibody
ABF6441 100 ug
EUR 438.00
anti-STAT4
YF-PA14815 50 ul
EUR 363.00
Description: Mouse polyclonal to STAT4
anti-STAT4
YF-PA14816 100 ug
EUR 403.00
Description: Rabbit polyclonal to STAT4
anti-STAT4
YF-PA24780 50 ul
EUR 334.00
Description: Mouse polyclonal to STAT4
Stat4 Blocking Peptide
33R-10499 50 ug
EUR 349.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Stat4 antibody, catalog no. 20R-1594
STAT4 Blocking Peptide
33R-10775 50 ug
EUR 191.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STAT4 antibody, catalog no. 70R-11849
Stat4 Blocking Peptide
3471RBP-50
EUR 153.00
STAT4 antibody (Tyr693)
70R-37128 100 ug
EUR 349.00
Description: Rabbit Polyclonal STAT4 antibody (Tyr693)
STAT4 antibody (Tyr693)
70R-32516 100 ug
EUR 327.00
Description: Rabbit polyclonal STAT4 antibody (Tyr693)
STAT4 (pS721) Antibody
abx218786-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.
STAT4 (pY693) Antibody
20-abx119324
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
STAT4 (pY693) Antibody
20-abx133340
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.
STAT4 (pY693) Antibody
20-abx134579
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.
STAT4 (pY693) Antibody
abx011816-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.
STAT4 Blocking Peptide
20-abx061715
  • EUR 258.00
  • EUR 384.00
  • 0
  • 1
  • Shipped within 5-10 working days.
STAT4 Polyclonal Antibody
EA238-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against STAT4 from Human. This antibody is tested and validated for WB, ELISA, IHC
STAT4 Polyclonal Antibody
EA238-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against STAT4 from Human. This antibody is tested and validated for WB, ELISA, IHC
STAT4 Conjugated Antibody
C49252 100ul
EUR 397.00
STAT4 Blocking Peptide
AF6441-BP 1mg
EUR 195.00
STAT4 cloning plasmid
CSB-CL022813HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2247
  • Sequence: atgtctcagtggaatcaagtccaacagttagaaatcaagtttttggagcaggtggatcaattctatgatgacaactttcccatggaaattcggcatctgttggcccaatggattgaaaatcaagactgggaggcagcttctaacaatgaaaccatggcaacgattcttcttcaaa
  • Show more
Description: A cloning plasmid for the STAT4 gene.
Stat4 Polyclonal Antibody
ABP52514-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
  • Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human, Mouse, Rat. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
Stat4 Polyclonal Antibody
ABP52514-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
  • Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human, Mouse, Rat. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
Stat4 Polyclonal Antibody
ABP52514-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
  • Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human, Mouse, Rat. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
STAT4 Rabbit pAb
A6991-100ul 100 ul
EUR 308.00
STAT4 Rabbit pAb
A6991-200ul 200 ul
EUR 459.00
STAT4 Rabbit pAb
A6991-20ul 20 ul
EUR 183.00
STAT4 Rabbit pAb
A6991-50ul 50 ul
EUR 223.00
STAT4 Rabbit pAb
A2638-100ul 100 ul
EUR 308.00
STAT4 Rabbit pAb
A2638-200ul 200 ul
EUR 459.00
STAT4 Rabbit pAb
A2638-20ul 20 ul
EUR 183.00
STAT4 Rabbit pAb
A2638-50ul 50 ul
EUR 223.00
STAT4 Rabbit mAb
A4523-100ul 100 ul
EUR 410.00
STAT4 Rabbit mAb
A4523-200ul 200 ul
EUR 571.00
STAT4 Rabbit mAb
A4523-20ul 20 ul
EUR 221.00
STAT4 Rabbit mAb
A4523-50ul 50 ul
EUR 287.00
Stat4 Polyclonal Antibody
ABP57268-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
  • Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
Stat4 Polyclonal Antibody
ABP57268-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
  • Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
Stat4 Polyclonal Antibody
ABP57268-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
  • Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
Stat4 Polyclonal Antibody
ABP57269-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693
  • Applications tips:
Description: A polyclonal antibody for detection of Stat4 from Human. This Stat4 antibody is for WB, IHC-P, IP, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Stat4 around the non-phosphorylation site of Y693