tef 3

TEF siRNA
20-abx905518
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TEF Antibody
47860-100ul 100ul
EUR 252.00
TEF antibody
70R-31839 100 ug
EUR 327.00
Description: Rabbit polyclonal TEF antibody
TEF Antibody
ABD3248 100 ug
EUR 438.00
TEF Antibody
1-CSB-PA608815LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TEF. Recognizes TEF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000
TEF siRNA
20-abx936457
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TEF siRNA
20-abx936458
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TEF Antibody
1-CSB-PA004254
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TEF. Recognizes TEF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
anti-TEF
YF-PA14978 50 ul
EUR 363.00
Description: Mouse polyclonal to TEF
anti-TEF
YF-PA14979 50 ug
EUR 363.00
Description: Mouse polyclonal to TEF
TEF Antibody
DF3248 200ul
EUR 304.00
Description: TEF Antibody detects endogenous levels of total TEF.
Transcriptional enhancer factor TEF-3 Antibody
20-abx109383
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-TEF Antibody
A05436 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for TEF Antibody (TEF) detection.tested for WB in Human, Mouse, Rat.
TEF Polyclonal Antibody
ABP52580-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human TEF at AA range: 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of TEF from Human, Mouse, Rat. This TEF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TEF at AA range: 180-260
TEF Polyclonal Antibody
ABP52580-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human TEF at AA range: 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of TEF from Human, Mouse, Rat. This TEF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TEF at AA range: 180-260
TEF Polyclonal Antibody
ABP52580-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human TEF at AA range: 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of TEF from Human, Mouse, Rat. This TEF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TEF at AA range: 180-260
TEF Polyclonal Antibody
E-AB-33065-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: This gene encodes a member of the PAR (proline and acidic amino acid-rich) subfamily of basi
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat TEF for WB,IHC-p,ELISA applications.
TEF Polyclonal Antibody
E-AB-33065-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: This gene encodes a member of the PAR (proline and acidic amino acid-rich) subfamily of basi
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat TEF for WB,IHC-p,ELISA applications.
TEF Polyclonal Antibody
E-AB-33065-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: This gene encodes a member of the PAR (proline and acidic amino acid-rich) subfamily of basi
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat TEF for WB,IHC-p,ELISA applications.
TEF Polyclonal Antibody
ES3579-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against TEF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
TEF Polyclonal Antibody
ES3579-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against TEF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
TEF cloning plasmid
CSB-CL608815HU-10ug 10ug
EUR 364.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 912
  • Sequence: atgtccgacgcgggcggcggaaagaagccgcctgtggacccgcaggcaggacccggtccggggccggggcgcgcagctggggaaaggggcctgtcggggtccttccccctggtcctgaagaagctgatggagaaccccccgcgcgaggcgcgcctcgataaggaaaaggggaagga
  • Show more
Description: A cloning plasmid for the TEF gene.
TEF Conjugated Antibody
C47860 100ul
EUR 397.00
pRS313-TEF-CYC1
PVT12186 2 ug
EUR 911.00
pRS315-TEF-CYC1
PVT12191 2 ug
EUR 911.00
TEF Blocking Peptide
DF3248-BP 1mg
EUR 195.00
Anti-TEF antibody
STJ95960 200 µl
EUR 197.00
Description: Rabbit polyclonal to TEF.
Human Transcriptional enhancer factor TEF-3 (TEAD4)
1-CSB-EP618010HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 44.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Transcriptional enhancer factor TEF-3(TEAD4),partial expressed in E.coli
Human Transcriptional enhancer factor TEF-3 (TEAD4)
1-CSB-EP618010HUa2
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 56.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Transcriptional enhancer factor TEF-3(TEAD4),partial expressed in E.coli
Transcriptional enhancer factor TEF-3 Antibody (Biotin)
20-abx105990
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Transcriptional enhancer factor TEF-3 Antibody (HRP)
20-abx108825
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Transcriptional enhancer factor TEF-3 Antibody (FITC)
20-abx107405
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tef sgRNA CRISPR Lentivector (Rat) (Target 3)
K6926304 1.0 ug DNA
EUR 154.00
TEF sgRNA CRISPR Lentivector (Human) (Target 3)
K2356404 1.0 ug DNA
EUR 154.00
TEF 3'UTR Luciferase Stable Cell Line
TU025396 1.0 ml
EUR 2333.00
TEF 3'UTR GFP Stable Cell Line
TU075396 1.0 ml
EUR 2333.00
Tef sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3717204 1.0 ug DNA
EUR 154.00
Tef 3'UTR GFP Stable Cell Line
TU170353 1.0 ml Ask for price
Tef 3'UTR Luciferase Stable Cell Line
TU221755 1.0 ml Ask for price
Tef 3'UTR Luciferase Stable Cell Line
TU120353 1.0 ml Ask for price
Tef 3'UTR GFP Stable Cell Line
TU271755 1.0 ml Ask for price
TEF-1 Polyclonal Antibody
ABP56363-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human TEF-1 at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of TEF-1 from Human, Mouse, Rat. This TEF-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TEF-1 at AA range: 30-110
TEF-1 Polyclonal Antibody
ABP56363-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human TEF-1 at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of TEF-1 from Human, Mouse, Rat. This TEF-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TEF-1 at AA range: 30-110
TEF-1 Polyclonal Antibody
ABP56363-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human TEF-1 at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of TEF-1 from Human, Mouse, Rat. This TEF-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TEF-1 at AA range: 30-110
TEF-5 Polyclonal Antibody
ABP56364-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human TEF-5 at AA range: 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of TEF-5 from Human, Mouse. This TEF-5 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TEF-5 at AA range: 180-260
TEF-5 Polyclonal Antibody
ABP56364-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human TEF-5 at AA range: 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of TEF-5 from Human, Mouse. This TEF-5 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TEF-5 at AA range: 180-260
TEF-5 Polyclonal Antibody
ABP56364-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human TEF-5 at AA range: 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of TEF-5 from Human, Mouse. This TEF-5 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TEF-5 at AA range: 180-260
TEF-4 Polyclonal Antibody
ABP56768-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human TEF-4 at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of TEF-4 from Human, Mouse. This TEF-4 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TEF-4 at AA range: 40-120
TEF-4 Polyclonal Antibody
ABP56768-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human TEF-4 at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of TEF-4 from Human, Mouse. This TEF-4 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TEF-4 at AA range: 40-120
TEF-4 Polyclonal Antibody
ABP56768-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human TEF-4 at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of TEF-4 from Human, Mouse. This TEF-4 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TEF-4 at AA range: 40-120
TEF protein (His tag)
80R-2875 20 ug
EUR 327.00
Description: Purified recombinant TEF protein (His tag)
TEF Antibody, HRP conjugated
1-CSB-PA608815LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TEF. Recognizes TEF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TEF Antibody, FITC conjugated
1-CSB-PA608815LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TEF. Recognizes TEF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TEF Antibody, Biotin conjugated
1-CSB-PA608815LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TEF. Recognizes TEF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
TEF-1 Polyclonal Antibody
ES7362-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against TEF-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
TEF-1 Polyclonal Antibody
ES7362-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against TEF-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
TEF-5 Polyclonal Antibody
ES7363-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against TEF-5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
TEF-5 Polyclonal Antibody
ES7363-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against TEF-5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
TEF-4 Polyclonal Antibody
ES7767-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against TEF-4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA
TEF-4 Polyclonal Antibody
ES7767-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against TEF-4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA
Mouse TEF shRNA Plasmid
20-abx973060
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat TEF shRNA Plasmid
20-abx985447
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TEF shRNA Plasmid
20-abx954785
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TEF Recombinant Protein (Human)
RP031255 100 ug Ask for price
Anserini TEF ELISA Kit
EAT0124 96Tests
EUR 521.00
TEF Recombinant Protein (Rat)
RP232745 100 ug Ask for price
TEF Recombinant Protein (Mouse)
RP178142 100 ug Ask for price
TEF Recombinant Protein (Mouse)
RP178145 100 ug Ask for price
Bovine TEF ELISA Kit
EBT0124 96Tests
EUR 521.00
Rat TEF ELISA Kit
ERT0124 96Tests
EUR 521.00
Rabbit TEF ELISA Kit
ERTT0124 96Tests
EUR 521.00
Human TEF ELISA Kit
EHT0124 96Tests
EUR 521.00
Porcine TEF ELISA Kit
EPT0124 96Tests
EUR 521.00
Mouse TEF ELISA Kit
EMT0124 96Tests
EUR 521.00
Canine TEF ELISA Kit
ECT0124 96Tests
EUR 521.00