TOMM40 siRNA
20-abx905730	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TOMM40 siRNA
20-abx937734	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TOMM40 siRNA
20-abx937735	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TOMM40 antibody
70R-20921	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TOMM40 antibody

TOMM40 Antibody
1-CSB-PA024050ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TOMM40. Recognizes TOMM40 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TOMM40 Antibody
1-CSB-PA024050GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TOMM40. Recognizes TOMM40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

pOTB7-TOMM40
PVT18966	Lifescience Market	2 ug	EUR 231

TOMM40 cloning plasmid
CSB-CL024050HU-10ug	Cusabio	10ug	EUR 413
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1086 Sequence: atggggaacgtgttggctgccagctcgccgcccgcagggccgccaccgccgcctgcgccggccctcgtggggctgccgccacctccgccctcgccgccgggcttcacgctgccgccgctgggaggcagcctgggcgccggcaccagtacgagtcgaagttcggaacggacccccg Show more
Description: A cloning plasmid for the TOMM40 gene.

TOMM40 Rabbit pAb
A3213-100ul	Abclonal	100 ul	EUR 308

TOMM40 Rabbit pAb
A3213-200ul	Abclonal	200 ul	EUR 459

TOMM40 Rabbit pAb
A3213-20ul	Abclonal	20 ul	EUR 183

TOMM40 Rabbit pAb
A3213-50ul	Abclonal	50 ul	EUR 223

TOMM40 Polyclonal Antibody
30434-100ul	SAB	100ul	EUR 252

TOMM40 Polyclonal Antibody
30434-50ul	SAB	50ul	EUR 187

Anti-TOMM40 Antibody
STJ503345	St John's Laboratory	100 µg	EUR 476

Anti-TOMM40 antibody
STJ72123	St John's Laboratory	100 µg	EUR 359

Anti-TOMM40 antibody
STJ25917	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is localized in the outer membrane of the mitochondria. It is the channel-forming subunit of the translocase of the mitochondrial outer membrane (TOM) complex that is essential for import of protein precursors into mitochondria. Alternatively spliced transcript variants have been found for this gene.

TOMM40 Polyclonal Conjugated Antibody
C30434	SAB	100ul	EUR 397

Mouse TOMM40 shRNA Plasmid
20-abx974325	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat TOMM40 shRNA Plasmid
20-abx989485	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Bovine TOMM40 ELISA KIT
ELI-16939b	Lifescience Market	96 Tests	EUR 928

Human TOMM40 ELISA KIT
ELI-45508h	Lifescience Market	96 Tests	EUR 824

Mouse Tomm40 ELISA KIT
ELI-40013m	Lifescience Market	96 Tests	EUR 865

Human TOMM40 shRNA Plasmid
20-abx957091	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TOMM40 Recombinant Protein (Human)
RP032548	ABM	100 ug	Ask for price

TOMM40 Recombinant Protein (Rat)
RP234227	ABM	100 ug	Ask for price

TOMM40 Recombinant Protein (Mouse)
RP180530	ABM	100 ug	Ask for price

TOMM40 Recombinant Protein (Mouse)
RP180533	ABM	100 ug	Ask for price

Anti-TOMM40 Antibody (Biotin)
STJ503346	St John's Laboratory	100 µg	EUR 586

Anti-TOMM40 Antibody (FITC)
STJ503347	St John's Laboratory	100 µg	EUR 586

Polyclonal TOMM40 Antibody (internal region)
APR10511G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TOMM40 (internal region). This antibody is tested and proven to work in the following applications:

Tomm40 ORF Vector (Mouse) (pORF)
ORF060178	ABM	1.0 ug DNA	EUR 506

Tomm40 ORF Vector (Mouse) (pORF)
ORF060179	ABM	1.0 ug DNA	EUR 506

Tomm40 ORF Vector (Rat) (pORF)
ORF078077	ABM	1.0 ug DNA	EUR 506

TOMM40 ORF Vector (Human) (pORF)
ORF010850	ABM	1.0 ug DNA	EUR 95

TOMM40 sgRNA CRISPR Lentivector set (Human)
K2423701	ABM	3 x 1.0 ug	EUR 339

Tomm40 sgRNA CRISPR Lentivector set (Mouse)
K4791801	ABM	3 x 1.0 ug	EUR 339

Tomm40 sgRNA CRISPR Lentivector set (Rat)
K7280201	ABM	3 x 1.0 ug	EUR 339

TOMM40 sgRNA CRISPR Lentivector (Human) (Target 1)
K2423702	ABM	1.0 ug DNA	EUR 154

TOMM40 sgRNA CRISPR Lentivector (Human) (Target 2)
K2423703	ABM	1.0 ug DNA	EUR 154

TOMM40 sgRNA CRISPR Lentivector (Human) (Target 3)
K2423704	ABM	1.0 ug DNA	EUR 154

Tomm40 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4791802	ABM	1.0 ug DNA	EUR 154

Tomm40 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4791803	ABM	1.0 ug DNA	EUR 154

Tomm40 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4791804	ABM	1.0 ug DNA	EUR 154

Tomm40 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7280202	ABM	1.0 ug DNA	EUR 154

Tomm40 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7280203	ABM	1.0 ug DNA	EUR 154

Tomm40 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7280204	ABM	1.0 ug DNA	EUR 154

TOMM40 Protein Vector (Human) (pPB-C-His)
PV043397	ABM	500 ng	EUR 329

TOMM40 Protein Vector (Human) (pPB-N-His)
PV043398	ABM	500 ng	EUR 329

TOMM40 Protein Vector (Human) (pPM-C-HA)
PV043399	ABM	500 ng	EUR 329

TOMM40 Protein Vector (Human) (pPM-C-His)
PV043400	ABM	500 ng	EUR 329

TOMM40 Protein Vector (Rat) (pPB-C-His)
PV312306	ABM	500 ng	EUR 603

TOMM40 Protein Vector (Rat) (pPB-N-His)
PV312307	ABM	500 ng	EUR 603

TOMM40 Protein Vector (Rat) (pPM-C-HA)
PV312308	ABM	500 ng	EUR 603

TOMM40 Protein Vector (Rat) (pPM-C-His)
PV312309	ABM	500 ng	EUR 603

TOMM40 Protein Vector (Mouse) (pPB-C-His)
PV240710	ABM	500 ng	EUR 603

TOMM40 Protein Vector (Mouse) (pPB-N-His)
PV240711	ABM	500 ng	EUR 603

TOMM40 Protein Vector (Mouse) (pPM-C-HA)
PV240712	ABM	500 ng	EUR 603

TOMM40 Protein Vector (Mouse) (pPM-C-His)
PV240713	ABM	500 ng	EUR 603

TOMM40 Protein Vector (Mouse) (pPB-C-His)
PV240714	ABM	500 ng	EUR 603

TOMM40 Protein Vector (Mouse) (pPB-N-His)
PV240715	ABM	500 ng	EUR 603

TOMM40 Protein Vector (Mouse) (pPM-C-HA)
PV240716	ABM	500 ng	EUR 603

TOMM40 Protein Vector (Mouse) (pPM-C-His)
PV240717	ABM	500 ng	EUR 603

Tomm40 3'UTR GFP Stable Cell Line
TU170950	ABM	1.0 ml	Ask for price

TOMM40 3'UTR GFP Stable Cell Line
TU076104	ABM	1.0 ml	EUR 1394

Tomm40 3'UTR Luciferase Stable Cell Line
TU120950	ABM	1.0 ml	Ask for price

TOMM40 3'UTR Luciferase Stable Cell Line
TU026104	ABM	1.0 ml	EUR 1394

Tomm40 3'UTR Luciferase Stable Cell Line
TU222297	ABM	1.0 ml	Ask for price

Tomm40 3'UTR GFP Stable Cell Line
TU272297	ABM	1.0 ml	Ask for price

Mitochondrial Import Receptor Subunit TOM40 Homolog (Tomm40) Antibody
20-abx116216	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Mitochondrial Import Receptor Subunit TOM40 Homolog (TOMM40) Antibody
20-abx002306	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Mitochondrial Import Receptor Subunit TOM40 Homolog (TOMM40) Antibody
abx145426-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Mitochondrial Import Receptor Subunit TOM40 Homolog (TOMM40) Antibody
20-abx320550	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Mitochondrial Import Receptor Subunit TOM40 Homolog (TOMM40) Antibody
abx431965-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Human Mitochondrial import receptor subunit TOM40 homolog (TOMM40)
1-CSB-EP024050HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 64.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Mitochondrial import receptor subunit TOM40 homolog(TOMM40) expressed in E.coli