TOMM40

TOMM40 siRNA
20-abx905730
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
TOMM40 siRNA
20-abx937734
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
TOMM40 siRNA
20-abx937735
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
TOMM40 antibody
70R-20921 50 ul
EUR 435.00
Description: Rabbit polyclonal TOMM40 antibody
TOMM40 Antibody
1-CSB-PA024050ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TOMM40. Recognizes TOMM40 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
TOMM40 Antibody
1-CSB-PA024050GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TOMM40. Recognizes TOMM40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
pOTB7-TOMM40
PVT18966 2 ug
EUR 231.00
TOMM40 cloning plasmid
CSB-CL024050HU-10ug 10ug
EUR 413.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1086
  • Sequence: atggggaacgtgttggctgccagctcgccgcccgcagggccgccaccgccgcctgcgccggccctcgtggggctgccgccacctccgccctcgccgccgggcttcacgctgccgccgctgggaggcagcctgggcgccggcaccagtacgagtcgaagttcggaacggacccccg
  • Show more
Description: A cloning plasmid for the TOMM40 gene.
TOMM40 Rabbit pAb
A3213-100ul 100 ul
EUR 308.00
TOMM40 Rabbit pAb
A3213-200ul 200 ul
EUR 459.00
TOMM40 Rabbit pAb
A3213-20ul 20 ul
EUR 183.00
TOMM40 Rabbit pAb
A3213-50ul 50 ul
EUR 223.00
TOMM40 Polyclonal Antibody
30434-100ul 100ul
EUR 252.00
TOMM40 Polyclonal Antibody
30434-50ul 50ul
EUR 187.00
Anti-TOMM40 Antibody
STJ503345 100 µg
EUR 476.00
Anti-TOMM40 antibody
STJ72123 100 µg
EUR 359.00
Anti-TOMM40 antibody
STJ25917 100 µl
EUR 277.00
Description: The protein encoded by this gene is localized in the outer membrane of the mitochondria. It is the channel-forming subunit of the translocase of the mitochondrial outer membrane (TOM) complex that is essential for import of protein precursors into mitochondria. Alternatively spliced transcript variants have been found for this gene.
TOMM40 Polyclonal Conjugated Antibody
C30434 100ul
EUR 397.00
Mouse TOMM40 shRNA Plasmid
20-abx974325
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Rat TOMM40 shRNA Plasmid
20-abx989485
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Bovine TOMM40 ELISA KIT
ELI-16939b 96 Tests
EUR 928.00
Human TOMM40 ELISA KIT
ELI-45508h 96 Tests
EUR 824.00
Mouse Tomm40 ELISA KIT
ELI-40013m 96 Tests
EUR 865.00
Human TOMM40 shRNA Plasmid
20-abx957091
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
TOMM40 Recombinant Protein (Human)
RP032548 100 ug Ask for price
TOMM40 Recombinant Protein (Rat)
RP234227 100 ug Ask for price
TOMM40 Recombinant Protein (Mouse)
RP180530 100 ug Ask for price
TOMM40 Recombinant Protein (Mouse)
RP180533 100 ug Ask for price
Anti-TOMM40 Antibody (Biotin)
STJ503346 100 µg
EUR 586.00
Anti-TOMM40 Antibody (FITC)
STJ503347 100 µg
EUR 586.00
Polyclonal TOMM40 Antibody (internal region)
APR10511G 0.1 mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TOMM40 (internal region). This antibody is tested and proven to work in the following applications:
Tomm40 ORF Vector (Mouse) (pORF)
ORF060178 1.0 ug DNA
EUR 506.00
Tomm40 ORF Vector (Mouse) (pORF)
ORF060179 1.0 ug DNA
EUR 506.00
Tomm40 ORF Vector (Rat) (pORF)
ORF078077 1.0 ug DNA
EUR 506.00
TOMM40 ORF Vector (Human) (pORF)
ORF010850 1.0 ug DNA
EUR 95.00
TOMM40 sgRNA CRISPR Lentivector set (Human)
K2423701 3 x 1.0 ug
EUR 339.00
Tomm40 sgRNA CRISPR Lentivector set (Mouse)
K4791801 3 x 1.0 ug
EUR 339.00
Tomm40 sgRNA CRISPR Lentivector set (Rat)
K7280201 3 x 1.0 ug
EUR 339.00
TOMM40 sgRNA CRISPR Lentivector (Human) (Target 1)
K2423702 1.0 ug DNA
EUR 154.00
TOMM40 sgRNA CRISPR Lentivector (Human) (Target 2)
K2423703 1.0 ug DNA
EUR 154.00
TOMM40 sgRNA CRISPR Lentivector (Human) (Target 3)
K2423704 1.0 ug DNA
EUR 154.00
Tomm40 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4791802 1.0 ug DNA
EUR 154.00
Tomm40 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4791803 1.0 ug DNA
EUR 154.00
Tomm40 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4791804 1.0 ug DNA
EUR 154.00
Tomm40 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7280202 1.0 ug DNA
EUR 154.00
Tomm40 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7280203 1.0 ug DNA
EUR 154.00
Tomm40 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7280204 1.0 ug DNA
EUR 154.00
TOMM40 Protein Vector (Human) (pPB-C-His)
PV043397 500 ng
EUR 329.00
TOMM40 Protein Vector (Human) (pPB-N-His)
PV043398 500 ng
EUR 329.00
TOMM40 Protein Vector (Human) (pPM-C-HA)
PV043399 500 ng
EUR 329.00
TOMM40 Protein Vector (Human) (pPM-C-His)
PV043400 500 ng
EUR 329.00
TOMM40 Protein Vector (Rat) (pPB-C-His)
PV312306 500 ng
EUR 603.00
TOMM40 Protein Vector (Rat) (pPB-N-His)
PV312307 500 ng
EUR 603.00
TOMM40 Protein Vector (Rat) (pPM-C-HA)
PV312308 500 ng
EUR 603.00
TOMM40 Protein Vector (Rat) (pPM-C-His)
PV312309 500 ng
EUR 603.00
TOMM40 Protein Vector (Mouse) (pPB-C-His)
PV240710 500 ng
EUR 603.00
TOMM40 Protein Vector (Mouse) (pPB-N-His)
PV240711 500 ng
EUR 603.00
TOMM40 Protein Vector (Mouse) (pPM-C-HA)
PV240712 500 ng
EUR 603.00
TOMM40 Protein Vector (Mouse) (pPM-C-His)
PV240713 500 ng
EUR 603.00
TOMM40 Protein Vector (Mouse) (pPB-C-His)
PV240714 500 ng
EUR 603.00
TOMM40 Protein Vector (Mouse) (pPB-N-His)
PV240715 500 ng
EUR 603.00
TOMM40 Protein Vector (Mouse) (pPM-C-HA)
PV240716 500 ng
EUR 603.00
TOMM40 Protein Vector (Mouse) (pPM-C-His)
PV240717 500 ng
EUR 603.00
Tomm40 3'UTR GFP Stable Cell Line
TU170950 1.0 ml Ask for price
TOMM40 3'UTR GFP Stable Cell Line
TU076104 1.0 ml
EUR 1394.00
Tomm40 3'UTR Luciferase Stable Cell Line
TU120950 1.0 ml Ask for price
TOMM40 3'UTR Luciferase Stable Cell Line
TU026104 1.0 ml
EUR 1394.00
Tomm40 3'UTR Luciferase Stable Cell Line
TU222297 1.0 ml Ask for price
Tomm40 3'UTR GFP Stable Cell Line
TU272297 1.0 ml Ask for price
Mitochondrial Import Receptor Subunit TOM40 Homolog (Tomm40) Antibody
20-abx116216
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Mitochondrial Import Receptor Subunit TOM40 Homolog (TOMM40) Antibody
20-abx002306
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
Mitochondrial Import Receptor Subunit TOM40 Homolog (TOMM40) Antibody
abx145426-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.
Mitochondrial Import Receptor Subunit TOM40 Homolog (TOMM40) Antibody
20-abx320550
  • EUR 300.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Mitochondrial Import Receptor Subunit TOM40 Homolog (TOMM40) Antibody
abx431965-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.
Human Mitochondrial import receptor subunit TOM40 homolog (TOMM40)
1-CSB-EP024050HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 64.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Mitochondrial import receptor subunit TOM40 homolog(TOMM40) expressed in E.coli