Human Tumor Protein p53 (TP53) ELISA Kit
DLR-TP53-Hu-96T	DL Develop	96T	EUR 621
Should the Human Tumor Protein p53 (TP53) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tumor Protein p53 (TP53) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Tumor Protein p53 (TP53) ELISA Kit
DLR-TP53-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse Tumor Protein p53 (TP53) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tumor Protein p53 (TP53) in samples from serum, plasma or other biological fluids.

Mouse Tumor Protein p53 (TP53) ELISA Kit
DLR-TP53-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse Tumor Protein p53 (TP53) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tumor Protein p53 (TP53) in samples from serum, plasma or other biological fluids.

Rat Tumor Protein p53 (TP53) ELISA Kit
DLR-TP53-Ra-48T	DL Develop	48T	EUR 508
Should the Rat Tumor Protein p53 (TP53) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Tumor Protein p53 (TP53) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Tumor Protein p53 (TP53) ELISA Kit
DLR-TP53-Ra-96T	DL Develop	96T	EUR 661
Should the Rat Tumor Protein p53 (TP53) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Tumor Protein p53 (TP53) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Tumor Protein p53 (TP53) ELISA Kit
RDR-TP53-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Tumor Protein p53 (TP53) ELISA Kit
RDR-TP53-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Tumor Protein p53 (TP53) ELISA Kit
RDR-TP53-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Tumor Protein p53 (TP53) ELISA Kit
RDR-TP53-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Tumor Protein p53 (TP53) ELISA Kit
RDR-TP53-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Tumor Protein p53 (TP53) ELISA Kit
RDR-TP53-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Human Tumor Protein p53 (TP53) ELISA Kit
RD-TP53-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Tumor Protein p53 (TP53) ELISA Kit
RD-TP53-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Mouse Tumor Protein p53 (TP53) ELISA Kit
RD-TP53-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Tumor Protein p53 (TP53) ELISA Kit
RD-TP53-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Rat Tumor Protein p53 (TP53) ELISA Kit
RD-TP53-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Tumor Protein p53 (TP53) ELISA Kit
RD-TP53-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

TP53 Antibody
31013-100ul	SAB	100ul	EUR 252

TP53 Antibody
31013-50ul	SAB	50ul	EUR 187

TP53 antibody
70R-20929	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TP53 antibody

TP53 Antibody
33023-100ul	SAB	100ul	EUR 252

TP53 Antibody
32051-100ul	SAB	100ul	EUR 252

TP53 antibody
38624-100ul	SAB	100ul	EUR 252

TP53 antibody
10R-3086	Fitzgerald	100 ug	EUR 407
Description: Mouse monoclonal TP53 antibody

TP53 antibody
10R-3087	Fitzgerald	100 ug	EUR 407
Description: Mouse monoclonal TP53 antibody

TP53 antibody
10R-3088	Fitzgerald	100 ug	EUR 407
Description: Mouse monoclonal TP53 antibody

TP53 antibody
10R-6101	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal TP53 antibody

TP53 antibody
10R-6102	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal TP53 antibody

TP53 antibody
10R-6104	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal TP53 antibody

TP53 antibody
10R-6106	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal TP53 antibody

TP53 antibody
10R-6109	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal TP53 antibody

TP53 antibody
10R-6110	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal TP53 antibody

TP53 antibody
10R-6111	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal TP53 antibody

TP53 antibody
10R-6113	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal TP53 antibody

TP53 antibody
10R-6114	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal TP53 antibody

TP53 antibody
10R-6116	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal TP53 antibody

TP53 antibody
10R-6117	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal TP53 antibody

TP53 antibody
10R-6118	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal TP53 antibody

TP53 Antibody
1-CSB-PA005967	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

TP53 Antibody
1-CSB-PA003666	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Monkey. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

TP53 Antibody
1-CSB-PA003667	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

TP53 Antibody
1-CSB-PA003668	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

TP53 Antibody
1-CSB-PA003670	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

TP53 Antibody
1-CSB-PA003672	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

TP53 Antibody
1-CSB-PA003675	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

TP53 Antibody
1-CSB-PA003676	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

TP53 Antibody
1-CSB-PA003677	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

TP53 Antibody
1-CSB-PA003678	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

TP53 Antibody
1-CSB-PA003680	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

TP53 Antibody
1-CSB-PA050301	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

TP53 Antibody
1-CSB-PA050302	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

TP53 Antibody
1-CSB-PA050303	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

TP53 Antibody
1-CSB-PA050304	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

TP53 Antibody
1-CSB-PA050305	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

TP53 Antibody
1-CSB-PA050306	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

TP53 Antibody
1-CSB-PA07889A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, ChIP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

TP53 Antibody
1-CSB-PA080174	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TP53. Recognizes TP53 from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:500-1000

TP53 Antibody
DF7238	Affbiotech	200ul	EUR 304
Description: TP53 Antibody detects endogenous levels of total TP53.

TP53 Antibody
1-CSB-PA150453	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:500-1:2000

Tp53 Antibody
1-CSB-PA15509A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Tp53. Recognizes Tp53 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

TP53 Antibody
1-CSB-PA024077GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Tp53 Antibody
1-CSB-PA024077LA01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Tp53. Recognizes Tp53 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

TP53 siRNA
20-abx905739	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TP53 siRNA
20-abx937803	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TP53 siRNA
20-abx937804	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TP53 Antibody
ABD7238	Lifescience Market	100 ug	EUR 438

p53/TP53/ Rat p53/ TP53 ELISA Kit
ELA-E0928r	Lifescience Market	96 Tests	EUR 886

TP53 antibody (Ser392)
70R-15039	Fitzgerald	100 ul	EUR 392
Description: Rabbit polyclonal TP53 antibody (Ser392)

TP53 Blocking Peptide
DF7238-BP	Affbiotech	1mg	EUR 195

TP53 Conjugated Antibody
C32051	SAB	100ul	EUR 397

TP53 Conjugated Antibody
C31013	SAB	100ul	EUR 397

TP53 (pS392) Antibody
abx332925-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

TP53 (pS20) Antibody
abx333347-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

TP53 (pS366) Antibody
abx333560-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

TP53 cloning plasmid
CSB-CL024077HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1182 Sequence: atggaggagccgcagtcagatcctagcgtcgagccccctctgagtcaggaaacattttcagacctatggaaactacttcctgaaaacaacgttctgtcccccttgccgtcccaagcaatggatgatttgatgctgtccccggacgatattgaacaatggttcactgaagacccag Show more
Description: A cloning plasmid for the TP53 gene.