
Human Tumor Protein p53 (TP53) ELISA Kit
DLR-TP53-Hu-96T 96T
EUR 621
  • Should the Human Tumor Protein p53 (TP53) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tumor Protein p53 (TP53) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Tumor Protein p53 (TP53) ELISA Kit
DLR-TP53-Mu-48T 48T
EUR 489
  • Should the Mouse Tumor Protein p53 (TP53) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tumor Protein p53 (TP53) in samples from serum, plasma or other biological fluids.
Mouse Tumor Protein p53 (TP53) ELISA Kit
DLR-TP53-Mu-96T 96T
EUR 635
  • Should the Mouse Tumor Protein p53 (TP53) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tumor Protein p53 (TP53) in samples from serum, plasma or other biological fluids.
Rat Tumor Protein p53 (TP53) ELISA Kit
DLR-TP53-Ra-48T 48T
EUR 508
  • Should the Rat Tumor Protein p53 (TP53) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Tumor Protein p53 (TP53) in samples from serum, plasma, tissue homogenates or other biological fluids.
Rat Tumor Protein p53 (TP53) ELISA Kit
DLR-TP53-Ra-96T 96T
EUR 661
  • Should the Rat Tumor Protein p53 (TP53) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Tumor Protein p53 (TP53) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Tumor Protein p53 (TP53) ELISA Kit
RDR-TP53-Hu-48Tests 48 Tests
EUR 500
Human Tumor Protein p53 (TP53) ELISA Kit
RDR-TP53-Hu-96Tests 96 Tests
EUR 692
Mouse Tumor Protein p53 (TP53) ELISA Kit
RDR-TP53-Mu-48Tests 48 Tests
EUR 511
Mouse Tumor Protein p53 (TP53) ELISA Kit
RDR-TP53-Mu-96Tests 96 Tests
EUR 709
Rat Tumor Protein p53 (TP53) ELISA Kit
RDR-TP53-Ra-48Tests 48 Tests
EUR 534
Rat Tumor Protein p53 (TP53) ELISA Kit
RDR-TP53-Ra-96Tests 96 Tests
EUR 742
Human Tumor Protein p53 (TP53) ELISA Kit
RD-TP53-Hu-48Tests 48 Tests
EUR 478
Human Tumor Protein p53 (TP53) ELISA Kit
RD-TP53-Hu-96Tests 96 Tests
EUR 662
Mouse Tumor Protein p53 (TP53) ELISA Kit
RD-TP53-Mu-48Tests 48 Tests
EUR 489
Mouse Tumor Protein p53 (TP53) ELISA Kit
RD-TP53-Mu-96Tests 96 Tests
EUR 677
Rat Tumor Protein p53 (TP53) ELISA Kit
RD-TP53-Ra-48Tests 48 Tests
EUR 511
Rat Tumor Protein p53 (TP53) ELISA Kit
RD-TP53-Ra-96Tests 96 Tests
EUR 709
TP53 Antibody
31013-100ul 100ul
EUR 252
TP53 Antibody
31013-50ul 50ul
EUR 187
TP53 antibody
70R-20929 50 ul
EUR 435
Description: Rabbit polyclonal TP53 antibody
TP53 Antibody
33023-100ul 100ul
EUR 252
TP53 Antibody
32051-100ul 100ul
EUR 252
TP53 antibody
38624-100ul 100ul
EUR 252
TP53 antibody
10R-3086 100 ug
EUR 407
Description: Mouse monoclonal TP53 antibody
TP53 antibody
10R-3087 100 ug
EUR 407
Description: Mouse monoclonal TP53 antibody
TP53 antibody
10R-3088 100 ug
EUR 407
Description: Mouse monoclonal TP53 antibody
TP53 antibody
10R-6101 100 ul
EUR 691
Description: Mouse monoclonal TP53 antibody
TP53 antibody
10R-6102 100 ul
EUR 691
Description: Mouse monoclonal TP53 antibody
TP53 antibody
10R-6104 100 ul
EUR 691
Description: Mouse monoclonal TP53 antibody
TP53 antibody
10R-6106 100 ul
EUR 691
Description: Mouse monoclonal TP53 antibody
TP53 antibody
10R-6109 100 ul
EUR 691
Description: Mouse monoclonal TP53 antibody
TP53 antibody
10R-6110 100 ul
EUR 691
Description: Mouse monoclonal TP53 antibody
TP53 antibody
10R-6111 100 ul
EUR 691
Description: Mouse monoclonal TP53 antibody
TP53 antibody
10R-6113 100 ul
EUR 691
Description: Mouse monoclonal TP53 antibody
TP53 antibody
10R-6114 100 ul
EUR 691
Description: Mouse monoclonal TP53 antibody
TP53 antibody
10R-6116 100 ul
EUR 691
Description: Mouse monoclonal TP53 antibody
TP53 antibody
10R-6117 100 ul
EUR 691
Description: Mouse monoclonal TP53 antibody
TP53 antibody
10R-6118 100 ul
EUR 691
Description: Mouse monoclonal TP53 antibody
TP53 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
TP53 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Monkey. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
TP53 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
TP53 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000
TP53 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000
TP53 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000
TP53 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
TP53 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
TP53 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000
TP53 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000
TP53 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000
TP53 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
TP53 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
TP53 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
TP53 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000
TP53 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000
TP53 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000
TP53 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, ChIP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200
TP53 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TP53. Recognizes TP53 from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:500-1000
TP53 Antibody
DF7238 200ul
EUR 304
Description: TP53 Antibody detects endogenous levels of total TP53.
TP53 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:500-1:2000
Tp53 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Tp53. Recognizes Tp53 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000
TP53 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TP53. Recognizes TP53 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
Tp53 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Tp53. Recognizes Tp53 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA
TP53 siRNA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TP53 siRNA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TP53 siRNA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TP53 Antibody
ABD7238 100 ug
EUR 438
p53/TP53/ Rat p53/ TP53 ELISA Kit
ELA-E0928r 96 Tests
EUR 886
TP53 antibody (Ser392)
70R-15039 100 ul
EUR 392
Description: Rabbit polyclonal TP53 antibody (Ser392)
TP53 Blocking Peptide
DF7238-BP 1mg
EUR 195
TP53 Conjugated Antibody
C32051 100ul
EUR 397
TP53 Conjugated Antibody
C31013 100ul
EUR 397
TP53 (pS392) Antibody
abx332925-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.
TP53 (pS20) Antibody
abx333347-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.
TP53 (pS366) Antibody
abx333560-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.
TP53 cloning plasmid
CSB-CL024077HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1182
  • Sequence: atggaggagccgcagtcagatcctagcgtcgagccccctctgagtcaggaaacattttcagacctatggaaactacttcctgaaaacaacgttctgtcccccttgccgtcccaagcaatggatgatttgatgctgtccccggacgatattgaacaatggttcactgaagacccag
  • Show more
Description: A cloning plasmid for the TP53 gene.