ZDHHC2

Rat Palmitoyltransferase ZDHHC2, Zdhhc2 ELISA KIT
ELI-28367r 96 Tests
EUR 886.00
Mouse Palmitoyltransferase ZDHHC2, Zdhhc2 ELISA KIT
ELI-40317m 96 Tests
EUR 865.00
ZDHHC2 siRNA
20-abx906162
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ZDHHC2 siRNA
20-abx940347
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ZDHHC2 siRNA
20-abx940348
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ZDHHC2 Antibody
ABD13388 100 ug
EUR 438.00
ZDHHC2 Antibody
ABD4688 100 ug
EUR 438.00
ZDHHC2 Antibody
1-CSB-PA883437LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZDHHC2. Recognizes ZDHHC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
ZDHHC2 Antibody
35205-100ul 100ul
EUR 252.00
ZDHHC2 Antibody
35205-50ul 50ul
EUR 187.00
ZDHHC2 Antibody
CSB-PA214532-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ZDHHC2. Recognizes ZDHHC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
ZDHHC2 Antibody
CSB-PA214532-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ZDHHC2. Recognizes ZDHHC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
ZDHHC2 Antibody
1-CSB-PA020268
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ZDHHC2. Recognizes ZDHHC2 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000
ZDHHC2 Antibody
DF4688 200ul
EUR 304.00
Description: ZDHHC2 Antibody detects endogenous levels of total ZDHHC2.
ZDHHC2 Antibody (HRP)
20-abx311722
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ZDHHC2 Antibody (FITC)
20-abx311723
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ZDHHC2 Antibody (Biotin)
20-abx311724
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-ZDHHC2 Antibody
A10325 100ul
EUR 397.00
Description: Rabbit Polyclonal ZDHHC2 Antibody. Validated in WB and tested in Human.
ZDHHC2 Polyclonal Antibody
ABP55504-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human ZDHHC2 at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of ZDHHC2 from Human, Mouse, Rat, Monkey. This ZDHHC2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ZDHHC2 at AA range: 30-110
ZDHHC2 Polyclonal Antibody
ABP55504-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human ZDHHC2 at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of ZDHHC2 from Human, Mouse, Rat, Monkey. This ZDHHC2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ZDHHC2 at AA range: 30-110
ZDHHC2 Polyclonal Antibody
ABP55504-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human ZDHHC2 at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of ZDHHC2 from Human, Mouse, Rat, Monkey. This ZDHHC2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ZDHHC2 at AA range: 30-110
ZDHHC2 Polyclonal Antibody
A61870 100 µg
EUR 570.55
Description: Ask the seller for details
ZDHHC2 Polyclonal Antibody
ES6503-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against ZDHHC2 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, WB, ELISA
ZDHHC2 Polyclonal Antibody
ES6503-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against ZDHHC2 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, WB, ELISA
ZDHHC2 Conjugated Antibody
C35205 100ul
EUR 397.00
ZDHHC2 cloning plasmid
CSB-CL883437HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1104
  • Sequence: atggcgccctcgggcccgggcagcagcgccaggcggcggtgccggcgggtgctgtactggatcccggtggtgttcatcaccctcctgctcggctggtcctactacgcctacgccatccagctgtgcatagtgtccatggaaaacactggcgaacaagttgtgtgcctgatggcct
  • Show more
Description: A cloning plasmid for the ZDHHC2 gene.
ZDHHC2 Rabbit pAb
A17979-100ul 100 ul
EUR 308.00
ZDHHC2 Rabbit pAb
A17979-200ul 200 ul
EUR 459.00
ZDHHC2 Rabbit pAb
A17979-20ul 20 ul
EUR 183.00
ZDHHC2 Rabbit pAb
A17979-50ul 50 ul
EUR 223.00
ZDHHC2 Blocking Peptide
DF4688-BP 1mg
EUR 195.00
Anti-ZDHHC2 antibody
STJ119957 100 µl
EUR 277.00
Anti-ZDHHC2 antibody
STJ96304 200 µl
EUR 197.00
Description: Rabbit polyclonal to ZDHHC2.
ZDHHC2 Antibody, HRP conjugated
1-CSB-PA883437LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZDHHC2. Recognizes ZDHHC2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ZDHHC2 Antibody, FITC conjugated
1-CSB-PA883437LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZDHHC2. Recognizes ZDHHC2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ZDHHC2 Antibody, Biotin conjugated
1-CSB-PA883437LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZDHHC2. Recognizes ZDHHC2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human ZDHHC2 shRNA Plasmid
20-abx959602
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse ZDHHC2 shRNA Plasmid
20-abx977240
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat ZDHHC2 shRNA Plasmid
20-abx987992
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ZDHHC2 Recombinant Protein (Human)
RP035305 100 ug Ask for price
ZDHHC2 Recombinant Protein (Rat)
RP238034 100 ug Ask for price
ZDHHC2 Recombinant Protein (Mouse)
RP186482 100 ug Ask for price
ZDHHC2 Polyclonal Antibody, Biotin Conjugated
A61871 100 µg
EUR 570.55
Description: The best epigenetics products
ZDHHC2 Polyclonal Antibody, FITC Conjugated
A61872 100 µg
EUR 570.55
Description: kits suitable for this type of research
ZDHHC2 Polyclonal Antibody, HRP Conjugated
A61873 100 µg
EUR 570.55
Description: fast delivery possible
ZDHHC2 ORF Vector (Human) (pORF)
ORF011769 1.0 ug DNA
EUR 95.00
Zdhhc2 ORF Vector (Mouse) (pORF)
ORF062162 1.0 ug DNA
EUR 506.00
Zdhhc2 ORF Vector (Rat) (pORF)
ORF079346 1.0 ug DNA
EUR 506.00
Zdhhc2 sgRNA CRISPR Lentivector set (Rat)
K6692801 3 x 1.0 ug
EUR 339.00
Zdhhc2 sgRNA CRISPR Lentivector set (Mouse)
K4038801 3 x 1.0 ug
EUR 339.00
ZDHHC2 sgRNA CRISPR Lentivector set (Human)
K2668401 3 x 1.0 ug
EUR 339.00
Zdhhc2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6692802 1.0 ug DNA
EUR 154.00
Zdhhc2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6692803 1.0 ug DNA
EUR 154.00
Zdhhc2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6692804 1.0 ug DNA
EUR 154.00
Zdhhc2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4038802 1.0 ug DNA
EUR 154.00
Zdhhc2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4038803 1.0 ug DNA
EUR 154.00
Zdhhc2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4038804 1.0 ug DNA
EUR 154.00
ZDHHC2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2668402 1.0 ug DNA
EUR 154.00
ZDHHC2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2668403 1.0 ug DNA
EUR 154.00
ZDHHC2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2668404 1.0 ug DNA
EUR 154.00
ZDHHC2 Protein Vector (Rat) (pPB-C-His)
PV317382 500 ng
EUR 603.00
ZDHHC2 Protein Vector (Rat) (pPB-N-His)
PV317383 500 ng
EUR 603.00
ZDHHC2 Protein Vector (Rat) (pPM-C-HA)
PV317384 500 ng
EUR 603.00
ZDHHC2 Protein Vector (Rat) (pPM-C-His)
PV317385 500 ng
EUR 603.00
ZDHHC2 Protein Vector (Human) (pPB-C-His)
PV047073 500 ng
EUR 329.00
ZDHHC2 Protein Vector (Human) (pPB-N-His)
PV047074 500 ng
EUR 329.00
ZDHHC2 Protein Vector (Human) (pPM-C-HA)
PV047075 500 ng
EUR 329.00
ZDHHC2 Protein Vector (Human) (pPM-C-His)
PV047076 500 ng
EUR 329.00
ZDHHC2 3'UTR Luciferase Stable Cell Line
TU028792 1.0 ml
EUR 2333.00
ZDHHC2 3'UTR GFP Stable Cell Line
TU078792 1.0 ml
EUR 2333.00
Zdhhc2 3'UTR GFP Stable Cell Line
TU172553 1.0 ml Ask for price
Zdhhc2 3'UTR Luciferase Stable Cell Line
TU223623 1.0 ml Ask for price
Zdhhc2 3'UTR Luciferase Stable Cell Line
TU122553 1.0 ml Ask for price
Zdhhc2 3'UTR GFP Stable Cell Line
TU273623 1.0 ml Ask for price
ZDHHC2 Protein Vector (Mouse) (pPB-C-His)
PV248646 500 ng
EUR 603.00